@lelgenio@lemmy.ml to Memes@lemmy.ml • 2 years agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square12fedilinkarrow-up1451file-text
arrow-up1451imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml@lelgenio@lemmy.ml to Memes@lemmy.ml • 2 years agomessage-square12fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-square@capy_bara@lemmy.worldlinkfedilink2•2 years agoThere is also epigenetic modifications to be considered
minus-square@Mininux@sh.itjust.workslinkfedilink1•2 years agoOh cool I didn’t know that stuff, it’s super interesting
There is also epigenetic modifications to be considered
Oh cool I didn’t know that stuff, it’s super interesting